Propagation of SmtB regulog to Desulfovibrio salexigens DSM 2638

Reference regulog properties
Source regulog:	SmtB - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heavy metal resistance
Effector:
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfovibrio salexigens DSM 2638
Orthologous TF(s)	Desal_1113
Regulated genes	1

Built upon 7 sites [see more]

Predicted regulatory interactions in *Desulfovibrio salexigens DSM 2638*
	Locus tag	Position	Score	Sequence
Position: -42 Score: 6.7 Sequence: TATATGAACAGTTGTTCATATA Locus tag: Desal_1113
	Desal_1113	-42	6.7	TATATGAACAGTTGTTCATATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: smtB
Ortholog function: Transcriptional regulator, ArsR family
Desulfovibrio salexigens DSM 2638	Desal_1113	-42	6.7	TATATGAACAGTTGTTCATATA
Desulfohalobium retbaense DSM 5692	Dret_2262	-47	5.7	TAATTGAACAATTGATCAAGCG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --