Propagation of TunR2 regulog to Desulfomicrobium baculatum DSM 4028

Reference regulog properties
Source regulog:	TunR2 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	TunR
Regulation mode:	activator
Biological process:	Molybdenum homeostasis; Metabolite transport
Effector:
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfomicrobium baculatum DSM 4028
Orthologous TF(s)	Dbac_3411, Dbac_1580
Regulated genes	1

Built upon 12 sites [see more]

Predicted regulatory interactions in *Desulfomicrobium baculatum DSM 4028*
	Locus tag	Position	Score	Sequence
Position: -114 Score: 6.3 Sequence: GTGACACGATAAAAATTAAAAAAATGTCTT Locus tag: Dbac_2091
	Dbac_2091	-114	6.3	GTGACACGATAAAAATTAAAAAAATGTCTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: DVU0770
Ortholog function: TSUP family transporter
Desulfomicrobium baculatum DSM 4028	Dbac_2091	-114	6.3	GTGACACGATAAAAATTAAAAAAATGTCTT
Desulfovibrio magneticus RS-1	DMR_43930	-49	5.9	CTGACACGTATATTATAAAACCGGTGTGAG
Desulfovibrio vulgaris Hildenborough	DVU0770	-50	5.7	CTGACACGATACATGATATTTTCGTGCCTC
Desulfovibrio vulgaris str. Miyazaki F	DvMF_2812	-213	6.1	CAGGCATGAAAATAAAATAATCCGTGACAA
		-157	7.5	TTGACACGAAGATTATAAAAAACGTGTCAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --