Propagation of DVU1964/DVU1967 regulog to Desulfomicrobium baculatum DSM 4028
| Source regulog: | DVU1964/DVU1967 - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Propagated regulon: | |
| Target genome | Desulfomicrobium baculatum DSM 4028 |
| Orthologous TF(s) | Dbac_3187 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -17
Score: 4.4 Sequence: AATCATTCGAGATTATTATGAAG
Locus tag: Dbac_3187
|
||||
| Dbac_3187 | -17 | 4.4 | AATCATTCGAGATTATTATGAAG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: Dbac_3187 | ||||
| Ortholog function: Transcriptional regulator, Rrf2 family | ||||
| Desulfomicrobium baculatum DSM 4028 | Dbac_3187 | -17 | 4.4 | AATCATTCGAGATTATTATGAAG |