Propagation of ArsR2 regulog to Desulfomicrobium baculatum DSM 4028
| Source regulog: | ArsR2 - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Arsenic resistance |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Propagated regulon: | |
| Target genome | Desulfomicrobium baculatum DSM 4028 |
| Orthologous TF(s) | Dbac_2827 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -46
Score: 5.6 Sequence: GTTTTGACATCTTGACATAT
Locus tag: Dbac_2827
|
||||
| Dbac_2827 | -46 | 5.6 | GTTTTGACATCTTGACATAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: arsR2 | ||||
| Ortholog function: transcriptional regulator, ArsR family | ||||
| Desulfomicrobium baculatum DSM 4028 | Dbac_2827 | -46 | 5.6 | GTTTTGACATCTTGACATAT |