Propagation of SahR regulog to Lawsonia intracellularis PHE/MN1-00

Reference regulog properties
Source regulog:	SahR - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Methionine metabolism
Effector:	S-adenosylhomocysteine
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Lawsonia intracellularis PHE/MN1-00
Orthologous TF(s)	No orthologous TFs found
Regulated genes	3

Built upon 31 sites [see more]

Predicted regulatory interactions in *Lawsonia intracellularis PHE/MN1-00*
	Locus tag	Position	Score	Sequence
Position: -106 Score: 3.6 Sequence: ATATATACATTACCTGTTAA Locus tag: LI0670
	LI0670	-106	3.6	ATATATACATTACCTGTTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ahcY
Ortholog function: Adenosylhomocysteinase (EC 3.3.1.1)
Desulfovibrio vulgaris Hildenborough	DVU0607	-52	5.9	ACATCAAGTTTTCTTGATTT
Desulfovibrio vulgaris str. Miyazaki F	DvMF_2580	-103	5.3	AAATCAAGTTTTCTTGATGT
Desulfovibrio desulfuricans G20	Dde_3134	63	5.3	ACATCAACTTTTCTTGATTC
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Ddes_0039	-57	5.4	ATATGCGGATAACTTGATAC
		-35	5	GTATCAGCATAAATTGATTT
Desulfovibrio piger ATCC 29098	DESPIG_01930	-83	5.8	ATATCCAGATAGGCTGATAT
		-61	4.1	GCATCAAGCAAATTTGATAC
Desulfovibrio salexigens DSM 2638	Desal_3077	-39	3.7	ATATAAAGGTTTTGTTATGT
Desulfovibrio magneticus RS-1	DMR_43440	-18	6.7	ATATCAGGATATCTTGATAT
Desulfomicrobium baculatum DSM 4028	Dbac_2304	-45	6.7	ATATCAGGATATCTTGATAT
Desulfohalobium retbaense DSM 5692	Dret_2301	-172	4.7	TTATCAACTTTTTCAGATAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --