Propagation of SmtB regulog to Desulfovibrio vulgaris str. Miyazaki F
| Source regulog: | SmtB - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Heavy metal resistance |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Propagated regulon: | |
| Target genome | Desulfovibrio vulgaris str. Miyazaki F |
| Orthologous TF(s) | DvMF_1207 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -89
Score: 6.5 Sequence: CATATGAACACGTGTTCATATG
Locus tag: DvMF_2066
|
||||
| DvMF_2066 | -89 | 6.5 | CATATGAACACGTGTTCATATG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: DvMF_2066 | ||||
| Ortholog function: heavy metal translocating P-type ATPase | ||||
| Desulfovibrio vulgaris str. Miyazaki F | DvMF_2066 | -89 | 6.5 | CATATGAACACGTGTTCATATG |