Propagation of SmtB regulog to Desulfovibrio vulgaris str. Miyazaki F

Reference regulog properties
Source regulog:	SmtB - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heavy metal resistance
Effector:
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfovibrio vulgaris str. Miyazaki F
Orthologous TF(s)	DvMF_1207
Regulated genes	1

Built upon 7 sites [see more]

Predicted regulatory interactions in *Desulfovibrio vulgaris str. Miyazaki F*
	Locus tag	Position	Score	Sequence
Position: -89 Score: 6.5 Sequence: CATATGAACACGTGTTCATATG Locus tag: DvMF_2066
	DvMF_2066	-89	6.5	CATATGAACACGTGTTCATATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: DvMF_2066
Ortholog function: heavy metal translocating P-type ATPase
Desulfovibrio vulgaris str. Miyazaki F	DvMF_2066	-89	6.5	CATATGAACACGTGTTCATATG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --