Propagation of DVU0309 regulog to Desulfohalobium retbaense DSM 5692

Reference regulog properties
Source regulog:	DVU0309 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	LysR
Regulation mode:
Biological process:
Effector:
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfohalobium retbaense DSM 5692
Orthologous TF(s)	Dret_0355
Regulated genes	1

Built upon 14 sites [see more]

Predicted regulatory interactions in *Desulfohalobium retbaense DSM 5692*
	Locus tag	Position	Score	Sequence
Position: -184 Score: 5.3 Sequence: CCTATCAGAAATTTTGATAGC Locus tag: Dret_0354
	Dret_0354	-184	5.3	CCTATCAGAAATTTTGATAGC
Supported by regulated orthologs from reference regulons
Ortholog gene name: Dret_0354
Ortholog function: peptidase M24
Desulfohalobium retbaense DSM 5692	Dret_0354	-184	5.3	CCTATCAGAAATTTTGATAGC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --