Propagation of HrcA regulog to Desulfohalobium retbaense DSM 5692

Reference regulog properties
Source regulog:	HrcA - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfohalobium retbaense DSM 5692
Orthologous TF(s)	Dret_0305
Regulated genes	1

Built upon 7 sites [see more]

Predicted regulatory interactions in *Desulfohalobium retbaense DSM 5692*
	Locus tag	Position	Score	Sequence
Position: -69 Score: 6.8 Sequence: TTAGCACTCCCCTGACAGGAGTGCTAA Locus tag: Dret_2175
	Dret_2175	-69	6.8	TTAGCACTCCCCTGACAGGAGTGCTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: groS
Ortholog function: Heat shock protein 60 family co-chaperone GroES
Desulfovibrio magneticus RS-1	DMR_02720	-65	5.9	CTGGCACTCGCCGCAAGCGAGTGCCAG
Desulfomicrobium baculatum DSM 4028	Dbac_2625	-76	5.9	TTGGCACTCCCCATTGCCGAGCGCCAA
Desulfohalobium retbaense DSM 5692	Dret_2175	-69	6.8	TTAGCACTCCCCTGACAGGAGTGCTAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --