Propagation of SmtB regulog to Desulfohalobium retbaense DSM 5692
| Source regulog: | SmtB - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Heavy metal resistance |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Propagated regulon: | |
| Target genome | Desulfohalobium retbaense DSM 5692 |
| Orthologous TF(s) | Dret_2262 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -47
Score: 5.7 Sequence: TAATTGAACAATTGATCAAGCG
Locus tag: Dret_2262
|
||||
| Dret_2262 | -47 | 5.7 | TAATTGAACAATTGATCAAGCG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: smtB | ||||
| Ortholog function: Transcriptional regulator, ArsR family | ||||
| Desulfovibrio salexigens DSM 2638 | Desal_1113 | -42 | 6.7 | TATATGAACAGTTGTTCATATA |
| Desulfohalobium retbaense DSM 5692 | Dret_2262 | -47 | 5.7 | TAATTGAACAATTGATCAAGCG |