Propagation of DvMF_1994 regulog to Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Reference regulog properties
Source regulog:	DvMF_1994 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Orthologous TF(s)	No orthologous TFs found
Regulated genes	1

Built upon 4 sites [see more]

Predicted regulatory interactions in *Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774*
	Locus tag	Position	Score	Sequence
Position: -136 Score: 4.7 Sequence: GTCTTATACCTGATGCAATAT Locus tag: Ddes_2374
	Ddes_2374	-136	4.7	GTCTTATACCTGATGCAATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: DvMF_2004
Ortholog function: D-galactarate dehydratase/altronate hydrolase-like protein
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Ddes_2374	-136	4.7	GTCTTATACCTGATGCAATAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --