Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MntR regulog to Exiguobacterium sibiricum 255-15

Reference regulog properties
Source regulog: MntR - Bacillales
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor (activator)
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Firmicutes
Propagated regulon:
Target genome Exiguobacterium sibiricum 255-15
Orthologous TF(s) Exig_0894
Regulated genes 1
Built upon 16 sites [see more]
Predicted regulatory interactions in Exiguobacterium sibiricum 255-15
Locus tag Position Score Sequence
Position: -136
Score: 6.4
Sequence: AAATTTGCCTTAAGGAAACATT
Locus tag: Exig_2749
Exig_2749 -136 6.4 AAATTTGCCTTAAGGAAACATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntB
Ortholog function: Manganese ABC transporter (ATP-binding protein)
Bacillus pumilus SAFR-032 BPUM_3011 -119 5.8 AAAGTTTCCCTAAGGAAACAAA
Bacillus halodurans C-125 BH1389 -180 6.2 AAAGTTTACTTAGGGAAACTTT