Propagation of TM1030 regulog to Thermotoga sp. RQ2
| Source regulog: | TM1030 - Thermotogales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Thermotogae |
| Propagated regulon: | |
| Target genome | Thermotoga sp. RQ2 |
| Orthologous TF(s) | TRQ2_1778 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -34
Score: 7.1 Sequence: ATTTGACTGACCAGTCAATC
Locus tag: TRQ2_1780
|
||||
| TRQ2_1780 | -34 | 7.1 | ATTTGACTGACCAGTCAATC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: TM1028 | ||||
| Ortholog function: Predicted ABC transport system, ATP-binding protein | ||||
| Thermotoga maritima MSB8 | TM1028 | -34 | 7.1 | ATTTGACTGACCAGTCAATC |
| Thermotoga sp. RQ2 | TRQ2_1780 | -34 | 7.1 | ATTTGACTGACCAGTCAATC |
| Thermotoga neapolitana DSM 4359 | CTN_1539 | -63 | 5.9 | GATTGACTCATTAGTCAATT |
| Thermotoga neapolitana DSM 4359 | CTN_1538 | -63 | 5.9 | GATTGACTCATTAGTCAATT |
| Thermotoga petrophila RKU-1 | Tpet_1722 | -34 | 7.1 | ATTTGACTGACCAGTCAATC |
| Thermotoga naphthophila RKU-10 | Tnap_1736 | -34 | 7.1 | ATTTGACTGACCAGTCAATC |
| Thermotoga lettingae TMO | Tlet_1862 | -65 | 5.1 | TATTGACCACATGGTCAATA |