Propagation of GluR regulog to Thermotoga sp. RQ2

Reference regulog properties
Source regulog:	GluR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Glucose utilization; Trehalose utilization
Effector:	Glucose
Phylum:	Thermotogae
Propagated regulon:
Target genome	Thermotoga sp. RQ2
Orthologous TF(s)	TRQ2_0976
Regulated genes	2

Built upon 7 sites [see more]

Predicted regulatory interactions in *Thermotoga sp. RQ2*
	Locus tag	Position	Score	Sequence
Position: -48 Score: 6 Sequence: ATTTGATTACAACGTCATTTAAC Locus tag: TRQ2_0970
	TRQ2_0970	-48	6	ATTTGATTACAACGTCATTTAAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: treE
Ortholog function: Trehalose ABC transporter, substrate-binding component
Thermotoga sp. RQ2	TRQ2_0970	-48	6	ATTTGATTACAACGTCATTTAAC
Thermotoga neapolitana DSM 4359	CTN_0780	-387	4.8	ATTTgATTAtAccGTcAgTTAAc
Thermotoga petrophila RKU-1	Tpet_0954	-52	6	ATTTGATTATAACGTCATTTAAT
Thermotoga naphthophila RKU-10	Tnap_0600	-52	6	ATTTGATTATAACGTCATTTAAT

Position: -121 Score: 6.3 Sequence: ATTTAATTCCTTTGGAAATTAAT Locus tag: TRQ2_0973
	TRQ2_0973	-121	6.3	ATTTAATTCCTTTGGAAATTAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: gluE
Ortholog function: Glucose ABC transporter, substrate-binding component
Thermotoga sp. RQ2	TRQ2_0973	-121	6.3	ATTTAATTCCTTTGGAAATTAAT
Thermotoga neapolitana DSM 4359	CTN_0777	-121	6.3	ATTTGATTCCGTTGGAAATTAAT
Thermotoga naphthophila RKU-10	Tnap_0597	-133	6.3	ATTTAATTCCTTTGGAAATTAAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --