Propagation of UgpR regulog to Thermotoga maritima MSB8

Reference regulog properties
Source regulog:	UgpR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Possibly alpha-mannosides utilization
Effector:
Phylum:	Thermotogae
Propagated regulon:
Target genome	Thermotoga maritima MSB8
Orthologous TF(s)	TM1856
Regulated genes	1

Built upon 9 sites [see more]

Predicted regulatory interactions in *Thermotoga maritima MSB8*
	Locus tag	Position	Score	Sequence
Position: -30 Score: 6.5 Sequence: ATATGTAAGCGCTTACAGGA Locus tag: TM1856
	TM1856	-30	6.5	ATATGTAAGCGCTTACAGGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ugpR
Ortholog function: Predicted regulator of alpha-mannoside utilization, LacI family
Thermotoga maritima MSB8	TM1856	-30	6.5	ATATGTAAGCGCTTACAGGA
Thermotoga neapolitana DSM 4359	CTN_0791	-30	6.2	TTATGTAAGCGCTTACAGGA
Thermotoga petrophila RKU-1	Tpet_0941	-30	6.5	ATATGTAAGCGCTTACAGGA
Thermotoga naphthophila RKU-10	Tnap_0613	-30	6.5	ATATGTAAGCGCTTACAGGA
Thermotoga lettingae TMO	Tlet_1033	-208	5.9	TTATGGAAACGATTACATAT
		-32	5.9	ATATGAAAAGGATTACACAA
Thermosipho melanesiensis BI429	Tmel_0763	-34	6.2	AATTGTAAACGCTTACAAAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --