Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of TreR regulog to Thermotoga maritima MSB8

Reference regulog properties
Source regulog: TreR - Thermotogales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Trehalose utilization
Effector: Trehalose
Phylum: Thermotogae
Propagated regulon:
Target genome Thermotoga maritima MSB8
Orthologous TF(s) TM0393
Regulated genes 1
Built upon 19 sites [see more]
Predicted regulatory interactions in Thermotoga maritima MSB8
Locus tag Position Score Sequence
Position: -38
Score: 6.1
Sequence: ATTAATTCAAGTTACGAATAAAT
Locus tag: TM0392
TM0392 -38 6.1 ATTAATTCAAGTTACGAATAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: treT
Ortholog function: Trehalose synthase, nucleoside diphosphate glucose dependent
Thermotoga maritima MSB8 TM0392 -38 6.1 ATTAATTCAAGTTACGAATAAAT
Thermotoga sp. RQ2 TRQ2_0542 -38 6.1 ATTAATTCAAGTTACGAATAAAT
Thermotoga neapolitana DSM 4359 CTN_0277 -37 6.1 ATTAATTCAAGTTACGAATAAAT
Thermotoga petrophila RKU-1 Tpet_0528 -38 6.1 ATTAATTCAAGTTACGAATAAAT
Thermotoga naphthophila RKU-10 Tnap_0184 -38 6.1 ATTAATTCAAGTTACGAATAAAT
Thermotoga lettingae TMO Tlet_1841 -8 5.7 ATTAATTCATGTTACGACAAAAT
Thermosipho africanus TCF52B THA_843 -35 5.9 ATTTTTTCGAAATTCGAATTAAA
Thermosipho melanesiensis BI429 Tmel_1821 -38 5.6 ATTATTTCGAAATTCAAAAAAAT
Fervidobacterium nodosum Rt17-B1 Fnod_0451 -127 5.9 ATATATTCGAAATTCGAATATAT
© 2009-2020 RegPrecise