Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of TM1030 regulog to Thermotoga maritima MSB8

Reference regulog properties
Source regulog: TM1030 - Thermotogales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug resistance
Effector:
Phylum: Thermotogae
Propagated regulon:
Target genome Thermotoga maritima MSB8
Orthologous TF(s) TM1030
Regulated genes 1
Built upon 6 sites [see more]
Predicted regulatory interactions in Thermotoga maritima MSB8
Locus tag Position Score Sequence
Position: -34
Score: 7.1
Sequence: ATTTGACTGACCAGTCAATC
Locus tag: TM1028
TM1028 -34 7.1 ATTTGACTGACCAGTCAATC
Supported by regulated orthologs from reference regulons
Ortholog gene name: TM1028
Ortholog function: Predicted ABC transport system, ATP-binding protein
Thermotoga maritima MSB8 TM1028 -34 7.1 ATTTGACTGACCAGTCAATC
Thermotoga sp. RQ2 TRQ2_1780 -34 7.1 ATTTGACTGACCAGTCAATC
Thermotoga neapolitana DSM 4359 CTN_1539 -63 5.9 GATTGACTCATTAGTCAATT
Thermotoga neapolitana DSM 4359 CTN_1538 -63 5.9 GATTGACTCATTAGTCAATT
Thermotoga petrophila RKU-1 Tpet_1722 -34 7.1 ATTTGACTGACCAGTCAATC
Thermotoga naphthophila RKU-10 Tnap_1736 -34 7.1 ATTTGACTGACCAGTCAATC
Thermotoga lettingae TMO Tlet_1862 -65 5.1 TATTGACCACATGGTCAATA