Propagation of Zur regulog to Thermotoga naphthophila RKU-10

Reference regulog properties
Source regulog:	Zur - Thermotogales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Thermotogae
Propagated regulon:
Target genome	Thermotoga naphthophila RKU-10
Orthologous TF(s)	Tnap_0752
Regulated genes	1

Built upon 10 sites [see more]

Predicted regulatory interactions in *Thermotoga naphthophila RKU-10*
	Locus tag	Position	Score	Sequence
Position: -31 Score: 7 Sequence: TTGCAAATGCTTTGCATTTGCAG Locus tag: Tnap_0752
	Tnap_0752	-31	7	TTGCAAATGCTTTGCATTTGCAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: zur
Ortholog function: Zinc uptake transcriptional regulator, Fur family
Thermotoga maritima MSB8	TM0122	-31	7	TTGCAAATGCTTTGCATTTGCAG
Thermotoga sp. RQ2	TRQ2_0825	-31	7	TTGCAAATGCTTTGCATTTGCAG
Thermotoga neapolitana DSM 4359	CTN_0567	-31	7	TTGCAAATGCTTTGCATTTGCAG
Thermotoga petrophila RKU-1	Tpet_0802	-31	7	TTGCAAATGCTTTGCATTTGCAG
Thermotoga naphthophila RKU-10	Tnap_0752	-31	7	TTGCAAATGCTTTGCATTTGCAG
Thermosipho africanus TCF52B	THA_725	-42	6.9	ATGCAAATGATTTGCATTTGCAA
Thermosipho melanesiensis BI429	Tmel_0432	-37	6.7	ATGCAAATGATTTGCATTTTCAA
Petrotoga mobilis SJ95	Pmob_0990	-97	5.8	ATGCTTATGCAAATCAGTTGCAA
		-80	5.8	TTGCAAAAACAAATCGTTTGCAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --