Propagation of ManR regulog to Thermotoga naphthophila RKU-10
| Source regulog: | ManR - Thermotogales |
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | repressor |
| Biological process: | Mannan and beta-mannosides utilization |
| Effector: | Mannose |
| Phylum: | Thermotogae |
| Propagated regulon: | |
| Target genome | Thermotoga naphthophila RKU-10 |
| Orthologous TF(s) | Tnap_1568 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -38
Score: 7.5 Sequence: AAATAAGTAAAGTTTACTAATTA
Locus tag: Tnap_1565
|
||||
| Tnap_1565 | -38 | 7.5 | AAATAAGTAAAGTTTACTAATTA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: manB | ||||
| Ortholog function: Endo-1,4-beta-mannosidase | ||||
| Thermotoga maritima MSB8 | TM1227 | -38 | 7.5 | AAATAAGTAAAGTTTACTAATTA |
| Thermotoga sp. RQ2 | TRQ2_1591 | -38 | 7.5 | AAATAAGTAAAGTTTACTAATTA |
| Thermotoga neapolitana DSM 4359 | CTN_1345 | -38 | 6.9 | AAATAAGTACAGATTACTAATTA |
| Thermotoga petrophila RKU-1 | Tpet_1542 | -38 | 7.5 | AAATAAGTAAAGTTTACTAATTA |
| Thermotoga naphthophila RKU-10 | Tnap_1565 | -38 | 7.5 | AAATAAGTAAAGTTTACTAATTA |