Propagation of IolR regulog to Thermotoga naphthophila RKU-10

Reference regulog properties
Source regulog:	IolR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Inositol utilization
Effector:
Phylum:	Thermotogae
Propagated regulon:
Target genome	Thermotoga naphthophila RKU-10
Orthologous TF(s)	Tnap_0203
Regulated genes	1

Built upon 4 sites [see more]

Predicted regulatory interactions in *Thermotoga naphthophila RKU-10*
	Locus tag	Position	Score	Sequence
Position: -40 Score: 6.3 Sequence: GTTGGTTAGTAAATGAAAACAAA Locus tag: Tnap_0203
	Tnap_0203	-40	6.3	GTTGGTTAGTAAATGAAAACAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: iolR
Ortholog function: Regulator of myo-inositol utilization InoR, ROK family
Thermotoga maritima MSB8	TM0411	-39	6	GTTGGTTAGTTAACGATAACAAA
Thermotoga neapolitana DSM 4359	CTN_0258	-40	6.3	GTTGGTTAGTAAATGAAAACAAA
Thermotoga petrophila RKU-1	Tpet_0509	-40	6.3	GTTGGTTAGTAAATGAAAACAAA
Thermotoga naphthophila RKU-10	Tnap_0203	-40	6.3	GTTGGTTAGTAAATGAAAACAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --