Propagation of BglR regulog to Thermotoga naphthophila RKU-10

Reference regulog properties
Source regulog:	BglR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Cellobiose
Phylum:	Thermotogae
Propagated regulon:
Target genome	Thermotoga naphthophila RKU-10
Orthologous TF(s)	Tnap_0663, Tnap_0740
Regulated genes	1

Built upon 7 sites [see more]

Predicted regulatory interactions in *Thermotoga naphthophila RKU-10*
	Locus tag	Position	Score	Sequence
Position: -45 Score: 6.8 Sequence: AATTTCTTTCTGAGGAAGATAGA Locus tag: Tnap_0663
	Tnap_0663	-45	6.8	AATTTCTTTCTGAGGAAGATAGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: bglR
Ortholog function: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
Thermotoga maritima MSB8	TM0032	-45	6.8	AATTTCTTTCTGAGGAAGATAGA
Thermotoga sp. RQ2	TRQ2_0913	-45	6.8	AATTTCTTTCTGAGGAAGATAGA
Thermotoga neapolitana DSM 4359	CTN_0663	-49	6.5	AATTCCTTTCTGAGGAAGATAAT
Thermotoga petrophila RKU-1	Tpet_0891	29	6.8	AATtTCTTTCTGAGgAAGATAga
Thermotoga naphthophila RKU-10	Tnap_0663	-45	6.8	AATTTCTTTCTGAGGAAGATAGA
Thermotoga lettingae TMO	Tlet_1037	-55	6.3	AAAATCTTTTTTAGAAAGATATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --