Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Zur regulog to Thermotoga petrophila RKU-1

Reference regulog properties
Source regulog: Zur - Thermotogales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Thermotogae
Propagated regulon:
Target genome Thermotoga petrophila RKU-1
Orthologous TF(s) Tpet_0802
Regulated genes 1
Built upon 10 sites [see more]
Predicted regulatory interactions in Thermotoga petrophila RKU-1
Locus tag Position Score Sequence
Position: -31
Score: 7
Sequence: TTGCAAATGCTTTGCATTTGCAG
Locus tag: Tpet_0802
Tpet_0802 -31 7 TTGCAAATGCTTTGCATTTGCAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: zur
Ortholog function: Zinc uptake transcriptional regulator, Fur family
Thermotoga maritima MSB8 TM0122 -31 7 TTGCAAATGCTTTGCATTTGCAG
Thermotoga sp. RQ2 TRQ2_0825 -31 7 TTGCAAATGCTTTGCATTTGCAG
Thermotoga neapolitana DSM 4359 CTN_0567 -31 7 TTGCAAATGCTTTGCATTTGCAG
Thermotoga petrophila RKU-1 Tpet_0802 -31 7 TTGCAAATGCTTTGCATTTGCAG
Thermotoga naphthophila RKU-10 Tnap_0752 -31 7 TTGCAAATGCTTTGCATTTGCAG
Thermosipho africanus TCF52B THA_725 -42 6.9 ATGCAAATGATTTGCATTTGCAA
Thermosipho melanesiensis BI429 Tmel_0432 -37 6.7 ATGCAAATGATTTGCATTTTCAA
Petrotoga mobilis SJ95 Pmob_0990 -97 5.8 ATGCTTATGCAAATCAGTTGCAA
-80 5.8 TTGCAAAAACAAATCGTTTGCAT