Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of ManR regulog to Thermotoga petrophila RKU-1

Reference regulog properties
Source regulog: ManR - Thermotogales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Mannan and beta-mannosides utilization
Effector: Mannose
Phylum: Thermotogae
Propagated regulon:
Target genome Thermotoga petrophila RKU-1
Orthologous TF(s) Tpet_1544
Regulated genes 1
Built upon 9 sites [see more]
Predicted regulatory interactions in Thermotoga petrophila RKU-1
Locus tag Position Score Sequence
Position: -38
Score: 7.5
Sequence: AAATAAGTAAAGTTTACTAATTA
Locus tag: Tpet_1542
Tpet_1542 -38 7.5 AAATAAGTAAAGTTTACTAATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: manB
Ortholog function: Endo-1,4-beta-mannosidase
Thermotoga maritima MSB8 TM1227 -38 7.5 AAATAAGTAAAGTTTACTAATTA
Thermotoga sp. RQ2 TRQ2_1591 -38 7.5 AAATAAGTAAAGTTTACTAATTA
Thermotoga neapolitana DSM 4359 CTN_1345 -38 6.9 AAATAAGTACAGATTACTAATTA
Thermotoga petrophila RKU-1 Tpet_1542 -38 7.5 AAATAAGTAAAGTTTACTAATTA
Thermotoga naphthophila RKU-10 Tnap_1565 -38 7.5 AAATAAGTAAAGTTTACTAATTA