Propagation of ManR regulog to Thermotoga petrophila RKU-1

Reference regulog properties
Source regulog:	ManR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Mannan and beta-mannosides utilization
Effector:	Mannose
Phylum:	Thermotogae
Propagated regulon:
Target genome	Thermotoga petrophila RKU-1
Orthologous TF(s)	Tpet_1544
Regulated genes	1

Built upon 9 sites [see more]

Predicted regulatory interactions in *Thermotoga petrophila RKU-1*
	Locus tag	Position	Score	Sequence
Position: -38 Score: 7.5 Sequence: AAATAAGTAAAGTTTACTAATTA Locus tag: Tpet_1542
	Tpet_1542	-38	7.5	AAATAAGTAAAGTTTACTAATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: manB
Ortholog function: Endo-1,4-beta-mannosidase
Thermotoga maritima MSB8	TM1227	-38	7.5	AAATAAGTAAAGTTTACTAATTA
Thermotoga sp. RQ2	TRQ2_1591	-38	7.5	AAATAAGTAAAGTTTACTAATTA
Thermotoga neapolitana DSM 4359	CTN_1345	-38	6.9	AAATAAGTACAGATTACTAATTA
Thermotoga petrophila RKU-1	Tpet_1542	-38	7.5	AAATAAGTAAAGTTTACTAATTA
Thermotoga naphthophila RKU-10	Tnap_1565	-38	7.5	AAATAAGTAAAGTTTACTAATTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --