Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of ChiR regulog to Thermotoga petrophila RKU-1

Reference regulog properties
Source regulog: ChiR - Thermotogales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Chitobiose utilization
Effector: Chitobiose
Phylum: Thermotogae
Propagated regulon:
Target genome Thermotoga petrophila RKU-1
Orthologous TF(s) Tpet_0120
Regulated genes 1
Built upon 8 sites [see more]
Predicted regulatory interactions in Thermotoga petrophila RKU-1
Locus tag Position Score Sequence
Position: -43
Score: 7
Sequence: AAGTTGTTTGCAGCATGCAACTA
Locus tag: Tpet_0120
Tpet_0120 -43 7 AAGTTGTTTGCAGCATGCAACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: chiR
Ortholog function: Regulator of chitobiose utilization ChiR, ROK family
Thermotoga maritima MSB8 TM0808 -27 6.9 AAGTTGTTTGCGGCATGCAACTA
Thermotoga sp. RQ2 TRQ2_0118 -43 6.9 AAGTTGTTTGCGGCATGCAACTA
Thermotoga neapolitana DSM 4359 CTN_1770 -44 6.8 TAGTTGCTTGCAACACGCAACTA
Thermotoga petrophila RKU-1 Tpet_0120 -43 7 AAGTTGTTTGCAGCATGCAACTA
Thermotoga naphthophila RKU-10 Tnap_0121 -43 7 AAGTTGTTTGCAGCATGCAACTA
Thermotoga lettingae TMO Tlet_0036 -39 6.3 TAGTTGCAGTATGCAAGCAACTA
Thermosipho africanus TCF52B THA_1058 -42 6.5 TAGTTGATTGAAACAACCAACTA
Thermosipho melanesiensis BI429 Tmel_0688 -38 6.9 TAGTTGATTGAAGCAATCAACTA
© 2009-2020 RegPrecise