Propagation of GluR regulog to Thermotoga petrophila RKU-1

Reference regulog properties
Source regulog:	GluR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Glucose utilization; Trehalose utilization
Effector:	Glucose
Phylum:	Thermotogae
Propagated regulon:
Target genome	Thermotoga petrophila RKU-1
Orthologous TF(s)	Tpet_0957
Regulated genes	1

Built upon 7 sites [see more]

Predicted regulatory interactions in *Thermotoga petrophila RKU-1*
	Locus tag	Position	Score	Sequence
Position: -52 Score: 6 Sequence: ATTTGATTATAACGTCATTTAAT Locus tag: Tpet_0953
	Tpet_0953	-52	6	ATTTGATTATAACGTCATTTAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: amyE
Ortholog function: extracellular alpha-amylase precursor
Thermotoga neapolitana DSM 4359	CTN_0781	-387	4.8	ATTTgATTAtAccGTcAgTTAAc
Thermotoga petrophila RKU-1	Tpet_0953	-52	6	ATTTGATTATAACGTCATTTAAT
Thermotoga naphthophila RKU-10	Tnap_0601	-52	6	ATTTGATTATAACGTCATTTAAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --