Propagation of TM0766 regulog to Thermotoga petrophila RKU-1

Reference regulog properties
Source regulog:	TM0766 - Thermotogales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Phylum:	Thermotogae
Propagated regulon:
Target genome	Thermotoga petrophila RKU-1
Orthologous TF(s)	Tpet_0162
Regulated genes	1

Built upon 9 sites [see more]

Predicted regulatory interactions in *Thermotoga petrophila RKU-1*
	Locus tag	Position	Score	Sequence
Position: -35 Score: 7.4 Sequence: GTGTAATAGTATAATATTACAG Locus tag: Tpet_0162
	Tpet_0162	-35	7.4	GTGTAATAGTATAATATTACAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: TM0766
Ortholog function: hypothetical regulator TM0766, GntR family
Thermotoga maritima MSB8	TM0766	-36	7.4	GTGTAATAGTATAATATTACAG
Thermotoga sp. RQ2	TRQ2_0160	-35	7.4	GTGTAATAGTATAATATTACAG
Thermotoga neapolitana DSM 4359	CTN_1811	66	7.2	gTGTAATAgTAcAATATTACAG
Thermotoga petrophila RKU-1	Tpet_0162	-35	7.4	GTGTAATAGTATAATATTACAG
Thermotoga naphthophila RKU-10	Tnap_0564	-35	7.4	GTGTAATAGTATAATATTACAG
Thermotoga lettingae TMO	Tlet_1559	-37	6.7	CTGTAATGTTGTAGTATTACAG
Thermosipho melanesiensis BI429	Tmel_1133	-54	7.5	CTGTAATAGTATAATATTACAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --