Propagation of TM0766 regulog to Thermotoga petrophila RKU-1
Source regulog: | TM0766 - Thermotogales |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Hypothetical ABC transporter |
Effector: | |
Phylum: | Thermotogae |
Propagated regulon: | |
Target genome | Thermotoga petrophila RKU-1 |
Orthologous TF(s) | Tpet_0162 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -35
Score: 7.4 Sequence: GTGTAATAGTATAATATTACAG
Locus tag: Tpet_0162
|
||||
Tpet_0162 | -35 | 7.4 | GTGTAATAGTATAATATTACAG | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: TM0766 | ||||
Ortholog function: hypothetical regulator TM0766, GntR family | ||||
Thermotoga maritima MSB8 | TM0766 | -36 | 7.4 | GTGTAATAGTATAATATTACAG |
Thermotoga sp. RQ2 | TRQ2_0160 | -35 | 7.4 | GTGTAATAGTATAATATTACAG |
Thermotoga neapolitana DSM 4359 | CTN_1811 | 66 | 7.2 | gTGTAATAgTAcAATATTACAG |
Thermotoga petrophila RKU-1 | Tpet_0162 | -35 | 7.4 | GTGTAATAGTATAATATTACAG |
Thermotoga naphthophila RKU-10 | Tnap_0564 | -35 | 7.4 | GTGTAATAGTATAATATTACAG |
Thermotoga lettingae TMO | Tlet_1559 | -37 | 6.7 | CTGTAATGTTGTAGTATTACAG |
Thermosipho melanesiensis BI429 | Tmel_1133 | -54 | 7.5 | CTGTAATAGTATAATATTACAG |