Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of TreR regulog to Thermotoga lettingae TMO

Reference regulog properties
Source regulog: TreR - Thermotogales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Trehalose utilization
Effector: Trehalose
Phylum: Thermotogae
Propagated regulon:
Target genome Thermotoga lettingae TMO
Orthologous TF(s) Tlet_1840
Regulated genes 1
Built upon 19 sites [see more]
Predicted regulatory interactions in Thermotoga lettingae TMO
Locus tag Position Score Sequence
Position: -8
Score: 5.7
Sequence: ATTAATTCATGTTACGACAAAAT
Locus tag: Tlet_1844
Tlet_1844 -8 5.7 ATTAATTCATGTTACGACAAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: treX
Ortholog function: Predicted trehalose ABC transporter, substrate-binding component (Archaea-type)
Thermotoga lettingae TMO Tlet_1844 -8 5.7 ATTAATTCATGTTACGACAAAAT
Thermotogales bacterium TBF 19.5.1 Kole_0303 -74 5.6 CTTTATTCAAGACTTGAATTTAT
© 2009-2020 RegPrecise