Propagation of HcpR regulog to Thermotoga lettingae TMO

Reference regulog properties
Source regulog:	HcpR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Phylum:	Thermotogae
Propagated regulon:
Target genome	Thermotoga lettingae TMO
Orthologous TF(s)	Tlet_1357
Regulated genes	2

Built upon 20 sites [see more]

Predicted regulatory interactions in *Thermotoga lettingae TMO*
	Locus tag	Position	Score	Sequence
Position: -79 Score: 5.7 Sequence: TTCGTAACAAAAGTTACTGT Locus tag: Tlet_0222
	Tlet_0222	-79	5.7	TTCGTAACAAAAGTTACTGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: hcp
Ortholog function: Hydroxylamine reductase (EC 1.7.-.-)
Thermotoga maritima MSB8	TM1172	-87	6.5	CCCGTAACAATTGTTACAGA
Thermotoga sp. RQ2	TRQ2_1643	-80	6.7	CCCGTAACAATTGTTACGGA
Thermotoga neapolitana DSM 4359	CTN_1403	-50	6.7	CCCGTAACAATTGTTACGGA
Thermotoga lettingae TMO	Tlet_0222	-79	5.7	TTCGTAACAAAAGTTACTGT
Thermosipho africanus TCF52B	THA_824	-79	6.1	TTCGTAACCTATGTTACAGA
Fervidobacterium nodosum Rt17-B1	Fnod_1302	-92	6.5	TCCGTAACATAGGTTACGGA

Position: -20 Score: 5.6 Sequence: GCGGTAACATATGATACAGA Locus tag: Tlet_1357
	Tlet_1357	-20	5.6	GCGGTAACATATGATACAGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: hcpR
Ortholog function: Transcriptional regulator HcpR, Crp/Fnr family
Thermotoga maritima MSB8	TM1171	-28	6.5	TCTGTAACAATTGTTACGGG
Thermotoga sp. RQ2	TRQ2_1644	-31	6.7	TCCGTAACAATTGTTACGGG
Thermotoga petrophila RKU-1	Tpet_1578	-28	6.3	TCTGTAACAATTGTTACGAG
Thermotoga naphthophila RKU-10	Tnap_1598	-28	6.3	TCTGTAACAATTGTTACGAG
Thermotoga lettingae TMO	Tlet_1357	-20	5.6	GCGGTAACATATGATACAGA
Fervidobacterium nodosum Rt17-B1	Fnod_1303	-229	6.5	TCCGTAACCTATGTTACGGA
Petrotoga mobilis SJ95	Pmob_1162	-52	6.2	TCAGTAACAAATGTTACGCA
Thermotogales bacterium TBF 19.5.1	Kole_1156	-28	6.6	TCGGTAACATATGTTACGGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --