Propagation of Zur regulog to Thermosipho melanesiensis BI429
Source regulog: | Zur - Thermotogales |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor |
Biological process: | Zinc homeostasis |
Effector: | Zinc ion, (Zn2+) |
Phylum: | Thermotogae |
Propagated regulon: | |
Target genome | Thermosipho melanesiensis BI429 |
Orthologous TF(s) | Tmel_0432 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -37
Score: 6.7 Sequence: ATGCAAATGATTTGCATTTTCAA
Locus tag: Tmel_0432
|
||||
Tmel_0432 | -37 | 6.7 | ATGCAAATGATTTGCATTTTCAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: zur | ||||
Ortholog function: Zinc uptake transcriptional regulator, Fur family | ||||
Thermotoga maritima MSB8 | TM0122 | -31 | 7 | TTGCAAATGCTTTGCATTTGCAG |
Thermotoga sp. RQ2 | TRQ2_0825 | -31 | 7 | TTGCAAATGCTTTGCATTTGCAG |
Thermotoga neapolitana DSM 4359 | CTN_0567 | -31 | 7 | TTGCAAATGCTTTGCATTTGCAG |
Thermotoga petrophila RKU-1 | Tpet_0802 | -31 | 7 | TTGCAAATGCTTTGCATTTGCAG |
Thermotoga naphthophila RKU-10 | Tnap_0752 | -31 | 7 | TTGCAAATGCTTTGCATTTGCAG |
Thermosipho africanus TCF52B | THA_725 | -42 | 6.9 | ATGCAAATGATTTGCATTTGCAA |
Thermosipho melanesiensis BI429 | Tmel_0432 | -37 | 6.7 | ATGCAAATGATTTGCATTTTCAA |
Petrotoga mobilis SJ95 | Pmob_0990 | -97 | 5.8 | ATGCTTATGCAAATCAGTTGCAA |
-80 | 5.8 | TTGCAAAAACAAATCGTTTGCAT | ||