Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of IolR regulog to Thermotoga neapolitana DSM 4359

Reference regulog properties
Source regulog: IolR - Thermotogales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Inositol utilization
Effector:
Phylum: Thermotogae
Propagated regulon:
Target genome Thermotoga neapolitana DSM 4359
Orthologous TF(s) CTN_0258
Regulated genes 1
Built upon 4 sites [see more]
Predicted regulatory interactions in Thermotoga neapolitana DSM 4359
Locus tag Position Score Sequence
Position: -40
Score: 6.3
Sequence: GTTGGTTAGTAAATGAAAACAAA
Locus tag: CTN_0258
CTN_0258 -40 6.3 GTTGGTTAGTAAATGAAAACAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: iolR
Ortholog function: Regulator of myo-inositol utilization InoR, ROK family
Thermotoga maritima MSB8 TM0411 -39 6 GTTGGTTAGTTAACGATAACAAA
Thermotoga neapolitana DSM 4359 CTN_0258 -40 6.3 GTTGGTTAGTAAATGAAAACAAA
Thermotoga petrophila RKU-1 Tpet_0509 -40 6.3 GTTGGTTAGTAAATGAAAACAAA
Thermotoga naphthophila RKU-10 Tnap_0203 -40 6.3 GTTGGTTAGTAAATGAAAACAAA
© 2009-2020 RegPrecise