Propagation of GluR regulog to Thermotoga neapolitana DSM 4359

Reference regulog properties
Source regulog:	GluR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Glucose utilization; Trehalose utilization
Effector:	Glucose
Phylum:	Thermotogae
Propagated regulon:
Target genome	Thermotoga neapolitana DSM 4359
Orthologous TF(s)	CTN_0774
Regulated genes	1

Built upon 7 sites [see more]

Predicted regulatory interactions in *Thermotoga neapolitana DSM 4359*
	Locus tag	Position	Score	Sequence
Position: -121 Score: 6.3 Sequence: ATTTGATTCCGTTGGAAATTAAT Locus tag: CTN_0777
	CTN_0777	-121	6.3	ATTTGATTCCGTTGGAAATTAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: gluE
Ortholog function: Glucose ABC transporter, substrate-binding component
Thermotoga sp. RQ2	TRQ2_0973	-121	6.3	ATTTAATTCCTTTGGAAATTAAT
Thermotoga neapolitana DSM 4359	CTN_0777	-121	6.3	ATTTGATTCCGTTGGAAATTAAT
Thermotoga naphthophila RKU-10	Tnap_0597	-133	6.3	ATTTAATTCCTTTGGAAATTAAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --