Propagation of BglR regulog to Thermotoga neapolitana DSM 4359

Reference regulog properties
Source regulog:	BglR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Cellobiose
Phylum:	Thermotogae
Propagated regulon:
Target genome	Thermotoga neapolitana DSM 4359
Orthologous TF(s)	CTN_0581, CTN_0663
Regulated genes	1

Built upon 7 sites [see more]

Predicted regulatory interactions in *Thermotoga neapolitana DSM 4359*
	Locus tag	Position	Score	Sequence
Position: -49 Score: 6.5 Sequence: AATTCCTTTCTGAGGAAGATAAT Locus tag: CTN_0660
	CTN_0660	-49	6.5	AATTCCTTTCTGAGGAAGATAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: bglX
Ortholog function: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653
Thermotoga neapolitana DSM 4359	CTN_0660	-49	6.5	AATTCCTTTCTGAGGAAGATAAT
Thermotoga lettingae TMO	Tlet_1038	-55	6.3	AAAATCTTTTTTAGAAAGATATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --