Propagation of TM0766 regulog to Thermosipho africanus TCF52B
| Source regulog: | TM0766 - Thermotogales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Hypothetical ABC transporter |
| Effector: | |
| Phylum: | Thermotogae |
| Propagated regulon: | |
| Target genome | Thermosipho africanus TCF52B |
| Orthologous TF(s) | THA_1439 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -38
Score: 7.6 Sequence: CTGTAATATTATAATATTACAG
Locus tag: THA_1439
|
||||
| THA_1439 | -38 | 7.6 | CTGTAATATTATAATATTACAG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: TM0766 | ||||
| Ortholog function: hypothetical regulator TM0766, GntR family | ||||
| Thermosipho africanus TCF52B | THA_1439 | -38 | 7.6 | CTGTAATATTATAATATTACAG |