Propagation of TM0766 regulog to Thermosipho africanus TCF52B

Reference regulog properties
Source regulog:	TM0766 - Thermotogales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Phylum:	Thermotogae
Propagated regulon:
Target genome	Thermosipho africanus TCF52B
Orthologous TF(s)	THA_1439
Regulated genes	1

Built upon 9 sites [see more]

Predicted regulatory interactions in *Thermosipho africanus TCF52B*
	Locus tag	Position	Score	Sequence
Position: -38 Score: 7.6 Sequence: CTGTAATATTATAATATTACAG Locus tag: THA_1439
	THA_1439	-38	7.6	CTGTAATATTATAATATTACAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: TM0766
Ortholog function: hypothetical regulator TM0766, GntR family
Thermosipho africanus TCF52B	THA_1439	-38	7.6	CTGTAATATTATAATATTACAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --