Propagation of TreR regulog to Thermotogales bacterium TBF 19.5.1

Reference regulog properties
Source regulog:	TreR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Phylum:	Thermotogae
Propagated regulon:
Target genome	Thermotogales bacterium TBF 19.5.1
Orthologous TF(s)	Kole_0300
Regulated genes	2

Built upon 19 sites [see more]

Predicted regulatory interactions in *Thermotogales bacterium TBF 19.5.1*
	Locus tag	Position	Score	Sequence
Position: -75 Score: 5.6 Sequence: ATTTATTCAATACATGAACAAAG Locus tag: Kole_0299
	Kole_0299	-75	5.6	ATTTATTCAATACATGAACAAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: treT
Ortholog function: Trehalose synthase, nucleoside diphosphate glucose dependent
Thermotogales bacterium TBF 19.5.1	Kole_0299	-75	5.6	ATTTATTCAATACATGAACAAAG

Position: -74 Score: 5.6 Sequence: CTTTATTCAAGACTTGAATTTAT Locus tag: Kole_0303
	Kole_0303	-74	5.6	CTTTATTCAAGACTTGAATTTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: treX
Ortholog function: Predicted trehalose ABC transporter, substrate-binding component (Archaea-type)
Thermotoga lettingae TMO	Tlet_1844	-8	5.7	ATTAATTCATGTTACGACAAAAT
Thermotogales bacterium TBF 19.5.1	Kole_0303	-74	5.6	CTTTATTCAAGACTTGAATTTAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --