Propagation of TM0766 regulog to Fervidobacterium nodosum Rt17-B1
| Source regulog: | TM0766 - Thermotogales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Hypothetical ABC transporter |
| Effector: | |
| Phylum: | Thermotogae |
| Propagated regulon: | |
| Target genome | Fervidobacterium nodosum Rt17-B1 |
| Orthologous TF(s) | Fnod_0429 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -68
Score: 7.3 Sequence: CTGTAATAGTACAATATTACAG
Locus tag: Fnod_0429
|
||||
| Fnod_0429 | -68 | 7.3 | CTGTAATAGTACAATATTACAG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: TM0766 | ||||
| Ortholog function: hypothetical regulator TM0766, GntR family | ||||
| Fervidobacterium nodosum Rt17-B1 | Fnod_0429 | -68 | 7.3 | CTGTAATAGTACAATATTACAG |