Propagation of TM0766 regulog to Fervidobacterium nodosum Rt17-B1

Reference regulog properties
Source regulog:	TM0766 - Thermotogales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Phylum:	Thermotogae
Propagated regulon:
Target genome	Fervidobacterium nodosum Rt17-B1
Orthologous TF(s)	Fnod_0429
Regulated genes	1

Built upon 9 sites [see more]

Predicted regulatory interactions in *Fervidobacterium nodosum Rt17-B1*
	Locus tag	Position	Score	Sequence
Position: -68 Score: 7.3 Sequence: CTGTAATAGTACAATATTACAG Locus tag: Fnod_0429
	Fnod_0429	-68	7.3	CTGTAATAGTACAATATTACAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: TM0766
Ortholog function: hypothetical regulator TM0766, GntR family
Fervidobacterium nodosum Rt17-B1	Fnod_0429	-68	7.3	CTGTAATAGTACAATATTACAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --