Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of YtrA regulog to Staphylococcus aureus subsp. aureus MW2

Reference regulog properties
Source regulog: YtrA - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Hypothetical ABC transporter
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus MW2
Orthologous TF(s) MW1875 (deprecated)
Regulated genes 1
Built upon 8 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus MW2
Locus tag Position Score Sequence
Position: -42
Score: 6.8
Sequence: TGTGTATATTGTATATATACA
Locus tag: MW1875 (deprecated)
MW1875 (deprecated) -42 6.8 TGTGTATATTGTATATATACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ytrA
Ortholog function: transcription regulator GntR family
Staphylococcus aureus subsp. aureus N315 SA1748 -42 6.8 TGTGTATATTGTATATATACA
Staphylococcus capitis SK14 STACA0001_1986 -40 7 TGTATATATTATGTATATACA
Staphylococcus epidermidis ATCC 12228 SE1625 -40 7 TGTATATATTATGTATATACA
Staphylococcus carnosus subsp. carnosus TM300 Sca_1508 -128 6.9 TGTATATATACAATATATACA
-38 6.8 TGTGTATACTGTGTATATACA
Staphylococcus haemolyticus JCSC1435 SH1021 -127 6.4 TGTATCTATAATGTATATACA
-41 6.6 TGTGTATACTATTTATATACA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0856 -40 6.7 TGTATATATTGCGTATATACA