Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MalR regulog to Staphylococcus aureus subsp. aureus MW2

Reference regulog properties
Source regulog: MalR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus MW2
Orthologous TF(s) MW1462 (deprecated)
Regulated genes 2
Built upon 5 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus MW2
Locus tag Position Score Sequence
Position: -66
Score: 6.7
Sequence: TTGTGCAAACGTTTTCACAA
Locus tag: MW0189 (deprecated)
MW0189 (deprecated) -66 6.7 TTGTGCAAACGTTTTCACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mdxK
Ortholog function: Maltose/maltodextrin transport ATP-binding protein
Staphylococcus aureus subsp. aureus N315 SA0206 -66 6.7 TTGTGCAAACGTTTTCACAA
Macrococcus caseolyticus JCSC5402 MCCL_0361 -110 6.7 TTATGCAATCGTTTGCAAAA
Position: -112
Score: 6.9
Sequence: TTATGCAATCGTTTGCACAA
Locus tag: MW1462 (deprecated)
MW1462 (deprecated) -112 6.9 TTATGCAATCGTTTGCACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: malR
Ortholog function: Maltose operon transcriptional repressor MalR, LacI family
Staphylococcus aureus subsp. aureus N315 SA1339 -112 6.9 TTATGCAATCGTTTGCACAA
Staphylococcus haemolyticus JCSC1435 SH1407 -228 6.6 TTATGCAAACGATTGCATTA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP1245 -106 6.4 TCGCGCAAACGTTTGCACAA
Macrococcus caseolyticus JCSC5402 MCCL_0356 -110 6.7 TTATGCAATCGTTTGCAAAA