Propagation of IcaR regulog to Staphylococcus aureus subsp. aureus MW2

Reference regulog properties
Source regulog:	IcaR - Staphylococcaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Intercellular adhesion
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Staphylococcus aureus subsp. aureus MW2
Orthologous TF(s)	MW2585 (deprecated)
Regulated genes	2

Built upon 4 sites [see more]

Predicted regulatory interactions in *Staphylococcus aureus subsp. aureus MW2*
	Locus tag	Position	Score	Sequence
Position: -156 Score: 7.2 Sequence: ACCTACCTTTCGTTAGTTAGGT Locus tag: MW2585 (deprecated)
	MW2585 (deprecated)	-156	7.2	ACCTACCTTTCGTTAGTTAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: icaR
Ortholog function: icaADBC operon transcriptional regulator
Staphylococcus aureus subsp. aureus N315	SA2458	-156	7.2	ACCTACCTTTCGTTAGTTAGGT
Staphylococcus capitis SK14	STACA0001_0089	-159	7.2	ACCTACCTTTCGTTAGTTAGGT

Position: -29 Score: 7.2 Sequence: ACCTAACTAACGAAAGGTAGGT Locus tag: MW2586 (deprecated)
	MW2586 (deprecated)	-29	7.2	ACCTAACTAACGAAAGGTAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: icaA
Ortholog function: polysaccharide intercellular adhesin biosynthesis N-glycosyltransferase (EC 2.4.-.-)
Staphylococcus aureus subsp. aureus N315	SA2459	-29	7.2	ACCTAACTAACGAAAGGTAGGT
Staphylococcus capitis SK14	STACA0001_0088	-29	7.2	ACCTAACTAACGAAAGGTAGGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --