Propagation of ArsR regulog to Staphylococcus aureus subsp. aureus MW2

Reference regulog properties
Source regulog:	ArsR - Staphylococcaceae
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenate; Arsenite
Phylum:	Firmicutes
Propagated regulon:
Target genome	Staphylococcus aureus subsp. aureus MW2
Orthologous TF(s)	MW1713 (deprecated)
Regulated genes	1

Built upon 26 sites [see more]

Predicted regulatory interactions in *Staphylococcus aureus subsp. aureus MW2*
	Locus tag	Position	Score	Sequence
Position: -40 Score: 6.9 Sequence: TATATAGATGATAATCTATTTA Locus tag: MW1713 (deprecated)
	MW1713 (deprecated)	-40	6.9	TATATAGATGATAATCTATTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: arsR
Ortholog function: arsenical resistance operon repressor
Staphylococcus aureus subsp. aureus N315	SA1591	-56	6.2	AATATAGACATTCATCTATATA
		-40	6.9	TATATAGATGATAATCTATTTA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	SSP2384	-56	5.4	AATATAGACACCAATCTATATA
		-40	6.5	TATATAGATGTTAGTCTATGTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --