Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CzrA regulog to Staphylococcus aureus subsp. aureus N315

Reference regulog properties
Source regulog: CzrA - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus N315
Orthologous TF(s) SA1947
Regulated genes 1
Built upon 6 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus N315
Locus tag Position Score Sequence
Position: -40
Score: 7.3
Sequence: AATATATGAACAAATATTCATATGAA
Locus tag: SA1947
SA1947 -40 7.3 AATATATGAACAAATATTCATATGAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: czrA
Ortholog function: zinc resistance repressor
Staphylococcus aureus subsp. aureus N315 SA1947 -40 7.3 AATATATGAACAAATATTCATATGAA
Staphylococcus capitis SK14 STACA0001_0851 -39 7.6 AATATATGAACAAATATTCATATAAA
Staphylococcus epidermidis ATCC 12228 SE1746 -21 7.7 AATATATGAACAAATATTCATATGTT
Staphylococcus carnosus subsp. carnosus TM300 Sca_1651 -45 7.5 TATATATGAATAGTTGTTCATATATT
Staphylococcus haemolyticus JCSC1435 SH0889 -41 8 AATATATGAACATATATTCATATATT
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0736 -52 7.9 AATATATGAACAAATATTCATATATT