Propagation of YdfL regulog to Bacillus cereus 03BB108
Source regulog: | YdfL - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | activator |
Biological process: | Multidrug resistance |
Effector: | |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Bacillus cereus 03BB108 |
Orthologous TF(s) | Bcer0_010100015594 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -63
Score: 6.3 Sequence: GACCTTCAAGTTACTTGAAGGTT
Locus tag: Bcer0_010100015589
|
||||
Bcer0_010100015589 | -63 | 6.3 | GACCTTCAAGTTACTTGAAGGTT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: BC1615 | ||||
Ortholog function: Na+ driven multidrug efflux pump | ||||
Bacillus licheniformis DSM 13 | BLi02817 | -58 | 6.2 | GACCTTCAAGTAACTTGAAGGTT |
Bacillus cereus ATCC 14579 | BC1615 | -66 | 6.3 | GACCTTCAAGTTACTTGAAGGTT |