Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of HrcA regulog to Staphylococcus aureus subsp. aureus MRSA252

Reference regulog properties
Source regulog: HrcA - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus MRSA252
Orthologous TF(s) SAR1659
Regulated genes 2
Built upon 14 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus MRSA252
Locus tag Position Score Sequence
Position: -39
Score: 6.8
Sequence: TTAGCACTTGAGATAAGTGAGTGCTAA
Locus tag: SAR1659
SAR1659 -39 6.8 TTAGCACTTGAGATAAGTGAGTGCTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: hrcA
Ortholog function: heat-inducible transcription repressor HrcA
Staphylococcus aureus subsp. aureus N315 SA1411 -38 6.8 TTAGCACTTGAGATAAGTGAGTGCTAA
Staphylococcus capitis SK14 STACA0001_1890 -40 7 TTAGCACTTGAGAGAAAAGAGTGCTAA
Staphylococcus epidermidis ATCC 12228 SE1269 -38 7.2 TTAGCACTTGAGATAAAAGAGTGCTAA
Staphylococcus carnosus subsp. carnosus TM300 Sca_1204 -38 6.8 TTAGCACTTGAGAGAAGAGAGTGCTAA
Staphylococcus haemolyticus JCSC1435 SH1334 -40 6.9 TTAGCACTTAGGACAAAAGAGTGCTAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP1175 -40 7 TTAGCACTTGAAACAAAAGAGTGCTAA
Macrococcus caseolyticus JCSC5402 MCCL_1234 -37 6.9 TTAGCACTTGAGGTGATAGAGTGCTAA
Position: -55
Score: 6.9
Sequence: TTAGCACTCTATAAAGTTAAGTGCTAA
Locus tag: SAR2117
SAR2117 -55 6.9 TTAGCACTCTATAAAGTTAAGTGCTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: groES
Ortholog function: chaperonin GroES protein
Staphylococcus aureus subsp. aureus N315 SA1837 -54 6.9 TTAGCACTCTTTAATGTTAAGTGCTAA
Staphylococcus capitis SK14 STACA0001_1993 -54 7.2 TTAGCACTCTAATAATTAAAGTGCTAA
Staphylococcus epidermidis ATCC 12228 SE1630 -54 7.1 TTAGCACTCTATATATCAAAGTGCTAA
Staphylococcus carnosus subsp. carnosus TM300 Sca_1541 -98 7.6 TTAGCACTCAATAATCAAGAGTGCTAA
Staphylococcus haemolyticus JCSC1435 SH1001 -55 7 TTAGCACTCATTATATTTAAGTGCTAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0847 -56 7 TTAGCACTCATTAACTTAAAGTGCTAA
Macrococcus caseolyticus JCSC5402 MCCL_1711 -61 7.1 TTAGCACTATATATAAGAGAGTGCTAA