Propagation of MntR regulog to Staphylococcus aureus subsp. aureus MSSA476
| Source regulog: | MntR - Staphylococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Staphylococcus aureus subsp. aureus MSSA476 |
| Orthologous TF(s) | SAS0600 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -42
Score: 6.1 Sequence: TAATTAGGTTAGCCTAAACT
Locus tag: SAS0599
|
||||
| SAS0599 | -42 | 6.1 | TAATTAGGTTAGCCTAAACT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mntA | ||||
| Ortholog function: manganese ABC transport system ATPase component MntA | ||||
| Staphylococcus aureus subsp. aureus N315 | SA0589 | -42 | 6.1 | TAATTAGGTTAGCCTAAACT |
| Staphylococcus capitis SK14 | STACA0001_0395 | -42 | 6.1 | AAATTAGGTTAGCCTAAACT |
| Staphylococcus epidermidis ATCC 12228 | SE0407 | -42 | 6.4 | AAATTAGGTTAACCTAAACT |
| Staphylococcus carnosus subsp. carnosus TM300 | Sca_0275 | -141 | 6.2 | AAATTAGGTTAGCCTAAAAA |
| Staphylococcus haemolyticus JCSC1435 | SH0143 | -40 | 6.4 | AAATTAGGTTAACCTAAACT |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | SSP2086 | -40 | 6.2 | AAATTAGGTTAGCCTAAAAA |
| Macrococcus caseolyticus JCSC5402 | MCCL_0095 | -52 | 5.9 | AGTTTAGGTTTGCCTAAAAT |
|
Position: -67
Score: 6.3 Sequence: AATTTAGGTTGACCTAAACA
Locus tag: SAS1040
|
||||
| SAS1040 | -67 | 6.3 | AATTTAGGTTGACCTAAACA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mntH | ||||
| Ortholog function: Mn2+/Fe2+ transporter, NRAMP family | ||||
| Staphylococcus aureus subsp. aureus N315 | SA0956 | -67 | 6.3 | AATTTAGGTTGACCTAAACA |
| Staphylococcus capitis SK14 | STACA0001_2258 | -66 | 6.1 | TTTTTAGGTTGACCTAACTT |
| Staphylococcus epidermidis ATCC 12228 | SE0803 | -51 | 6.3 | TTTTTAGGTTGACCTAATAT |
| -29 | 4.6 | TATTTAGGTTAATATATTCT | ||
| Staphylococcus carnosus subsp. carnosus TM300 | Sca_0731 | -76 | 6.1 | TTTTTAGGTTGACCTAACTT |
| Staphylococcus haemolyticus JCSC1435 | SH1847 | -65 | 6.3 | TTATTAGGTTGACCTAAAAA |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | SSP1685 | -73 | 6.3 | TTTTTAGGTTGACCTAATAA |
| Macrococcus caseolyticus JCSC5402 | MCCL_0368 | -52 | 5.7 | TTTTTAGGTTGCCCTAAAGA |