Propagation of MalR regulog to Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Reference regulog properties
Source regulog:	MalR - Staphylococcaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Orthologous TF(s)	SSP1245
Regulated genes	1

Built upon 5 sites [see more]

Predicted regulatory interactions in *Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305*
	Locus tag	Position	Score	Sequence
Position: -106 Score: 6.4 Sequence: TCGCGCAAACGTTTGCACAA Locus tag: SSP1245
	SSP1245	-106	6.4	TCGCGCAAACGTTTGCACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: malR
Ortholog function: Maltose operon transcriptional repressor MalR, LacI family
Staphylococcus aureus subsp. aureus N315	SA1339	-112	6.9	TTATGCAATCGTTTGCACAA
Staphylococcus haemolyticus JCSC1435	SH1407	-228	6.6	TTATGCAAACGATTGCATTA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	SSP1245	-106	6.4	TCGCGCAAACGTTTGCACAA
Macrococcus caseolyticus JCSC5402	MCCL_0356	-110	6.7	TTATGCAATCGTTTGCAAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --