Propagation of MalR regulog to Staphylococcus aureus subsp. aureus JH1
Source regulog: | MalR - Staphylococcaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Maltose utilization; Maltodextrin utilization |
Effector: | Maltose |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Staphylococcus aureus subsp. aureus JH1 |
Orthologous TF(s) | SaurJH1_1596 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -66
Score: 6.7 Sequence: TTGTGCAAACGTTTTCACAA
Locus tag: SaurJH1_0204
|
||||
SaurJH1_0204 | -66 | 6.7 | TTGTGCAAACGTTTTCACAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: mdxK | ||||
Ortholog function: Maltose/maltodextrin transport ATP-binding protein | ||||
Staphylococcus aureus subsp. aureus N315 | SA0206 | -66 | 6.7 | TTGTGCAAACGTTTTCACAA |
Macrococcus caseolyticus JCSC5402 | MCCL_0361 | -110 | 6.7 | TTATGCAATCGTTTGCAAAA |