Propagation of MalR regulog to Macrococcus caseolyticus JCSC5402

Reference regulog properties
Source regulog:	MalR - Staphylococcaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Macrococcus caseolyticus JCSC5402
Orthologous TF(s)	MCCL_0356
Regulated genes	1

Built upon 5 sites [see more]

Predicted regulatory interactions in *Macrococcus caseolyticus JCSC5402*
	Locus tag	Position	Score	Sequence
Position: -110 Score: 6.7 Sequence: TTATGCAATCGTTTGCAAAA Locus tag: MCCL_0353
	MCCL_0353	-110	6.7	TTATGCAATCGTTTGCAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mdxE
Ortholog function: Maltose/maltodextrin ABC transporter, substrate binding protein
Macrococcus caseolyticus JCSC5402	MCCL_0353	-110	6.7	TTATGCAATCGTTTGCAAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --