Propagation of MalR regulog to Macrococcus caseolyticus JCSC5402
| Source regulog: | MalR - Staphylococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Macrococcus caseolyticus JCSC5402 |
| Orthologous TF(s) | MCCL_0356 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -110
Score: 6.7 Sequence: TTATGCAATCGTTTGCAAAA
Locus tag: MCCL_0353
|
||||
| MCCL_0353 | -110 | 6.7 | TTATGCAATCGTTTGCAAAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mdxE | ||||
| Ortholog function: Maltose/maltodextrin ABC transporter, substrate binding protein | ||||
| Macrococcus caseolyticus JCSC5402 | MCCL_0353 | -110 | 6.7 | TTATGCAATCGTTTGCAAAA |