Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CzrA regulog to Bacillus cereus 03BB108

Reference regulog properties
Source regulog: CzrA - Bacillales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector: Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus cereus 03BB108
Orthologous TF(s) Bcer0_010100025528
Regulated genes 2
Built upon 16 sites [see more]
Predicted regulatory interactions in Bacillus cereus 03BB108
Locus tag Position Score Sequence
Position: -44
Score: 6.6
Sequence: TATATGAACAAATATTCATATG
Locus tag: Bcer0_010100002705
Bcer0_010100002705 -44 6.6 TATATGAACAAATATTCATATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: czcO
Ortholog function: CzcD accessory protein (oxidoreductase)
Bacillus subtilis subsp. subtilis str. 168 BSU26640 -116 7.1 TATATGAACACATGCTCATATA
Bacillus amyloliquefaciens FZB42 RBAM_005610 -106 6.9 TATATGAGCACATAATCATATA
Geobacillus kaustophilus HTA426 GK0582 -48 7 CATATGAACATATGCTCATATA
Bacillus cereus ATCC 14579 BC3447 -44 6 TATATGAACAAATATTCATACG
Position: -81
Score: 5.9
Sequence: CATATGAATAGACGCTCATATA
Position: -45
Score: 5.7
Sequence: TATATGAATGATTGTTCATATG
Locus tag: Bcer0_010100025528
Bcer0_010100025528 -81 5.9 CATATGAATAGACGCTCATATA
-45 5.7 TATATGAATGATTGTTCATATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: czrA
Ortholog function: Transcriptional repressor of multiple metal-sensing, ArsR family
Bacillus cereus ATCC 14579 BC0595 -46 5.7 TATATGAatgatTGtTCATATg