Propagation of GlvR regulog to Staphylococcus aureus subsp. aureus USA300_TCH1516

Reference regulog properties
Source regulog:	GlvR - Staphylococcaceae
Regulator type:	Transcription factor
Regulator family:	RpiR
Regulation mode:	activator
Biological process:	Maltose utilization
Effector:	Maltose-6-phosphate
Phylum:	Firmicutes
Propagated regulon:
Target genome	Staphylococcus aureus subsp. aureus USA300_TCH1516
Orthologous TF(s)	USA300HOU_2304
Regulated genes	1

Built upon 5 sites [see more]

Predicted regulatory interactions in *Staphylococcus aureus subsp. aureus USA300_TCH1516*
	Locus tag	Position	Score	Sequence
Position: -181 Score: 7.6 Sequence: TGAAAAAATTTTCACTATATGAAAA Locus tag: USA300HOU_2303
	USA300HOU_2303	-181	7.6	TGAAAAAATTTTCACTATATGAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: glvC
Ortholog function: maltose-specific PTS system, IIBC component
Staphylococcus aureus subsp. aureus N315	SA2114	-181	7.6	TGAAAAAATTTTCACTATATGAAAA
Staphylococcus capitis SK14	STACA0001_1166	-190	7.3	TGAAAAAATTTCCGTTCAATGAAAA
Staphylococcus epidermidis ATCC 12228	SE1897	-181	7.6	TGAAAATATTTTCTTTATATGAAAA
Staphylococcus haemolyticus JCSC1435	SH0732	-198	7.4	TGAAAATATTTTCATGTATAGAAAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	SSP0583	-193	7.4	TGAAAATATTTTCAACTTTTGAAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --