Propagation of YtrA regulog to Staphylococcus aureus subsp. aureus str. JKD6009

Reference regulog properties
Source regulog:	YtrA - Staphylococcaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Staphylococcus aureus subsp. aureus str. JKD6009
Orthologous TF(s)	SauraJ_010100001671
Regulated genes	1

Built upon 8 sites [see more]

Predicted regulatory interactions in *Staphylococcus aureus subsp. aureus str. JKD6009*
	Locus tag	Position	Score	Sequence
Position: -42 Score: 6.8 Sequence: TGTGTATATTGTATATATACA Locus tag: SauraJ_010100001671
	SauraJ_010100001671	-42	6.8	TGTGTATATTGTATATATACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ytrA
Ortholog function: transcription regulator GntR family
Staphylococcus aureus subsp. aureus N315	SA1748	-42	6.8	TGTGTATATTGTATATATACA
Staphylococcus capitis SK14	STACA0001_1986	-40	7	TGTATATATTATGTATATACA
Staphylococcus epidermidis ATCC 12228	SE1625	-40	7	TGTATATATTATGTATATACA
Staphylococcus carnosus subsp. carnosus TM300	Sca_1508	-128	6.9	TGTATATATACAATATATACA
		-38	6.8	TGTGTATACTGTGTATATACA
Staphylococcus haemolyticus JCSC1435	SH1021	-127	6.4	TGTATCTATAATGTATATACA
		-41	6.6	TGTGTATACTATTTATATACA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	SSP0856	-40	6.7	TGTATATATTGCGTATATACA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --