Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of GlvR regulog to Staphylococcus aureus subsp. aureus str. JKD6009

Reference regulog properties
Source regulog: GlvR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode: activator
Biological process: Maltose utilization
Effector: Maltose-6-phosphate
Phylum: Firmicutes
Propagated regulon:
Target genome Staphylococcus aureus subsp. aureus str. JKD6009
Orthologous TF(s) SauraJ_010100006408
Regulated genes 1
Built upon 5 sites [see more]
Predicted regulatory interactions in Staphylococcus aureus subsp. aureus str. JKD6009
Locus tag Position Score Sequence
Position: -181
Score: 7.6
Sequence: TGAAAAAATTTTCACTATATGAAAA
Locus tag: SauraJ_010100006403
SauraJ_010100006403 -181 7.6 TGAAAAAATTTTCACTATATGAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: glvC
Ortholog function: maltose-specific PTS system, IIBC component
Staphylococcus aureus subsp. aureus N315 SA2114 -181 7.6 TGAAAAAATTTTCACTATATGAAAA
Staphylococcus capitis SK14 STACA0001_1166 -190 7.3 TGAAAAAATTTCCGTTCAATGAAAA
Staphylococcus epidermidis ATCC 12228 SE1897 -181 7.6 TGAAAATATTTTCTTTATATGAAAA
Staphylococcus haemolyticus JCSC1435 SH0732 -198 7.4 TGAAAATATTTTCATGTATAGAAAA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 SSP0583 -193 7.4 TGAAAATATTTTCAACTTTTGAAAA