Propagation of UxuR regulog to Geobacillus thermodenitrificans NG80-2
| Source regulog: | UxuR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Glucuronate utilization |
| Effector: | Aldotetraouronic acid |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Geobacillus thermodenitrificans NG80-2 |
| Orthologous TF(s) | GTNG_1766 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -36
Score: 5.7 Sequence: CTACCATACTAGTATATAAA
Locus tag: GTNG_1766
|
||||
| GTNG_1766 | -36 | 5.7 | CTACCATACTAGTATATAAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: uxuR | ||||
| Ortholog function: Transcriptional regulator of glucuronate utilization, GntR family | ||||
| Bacillus clausii KSM-K16 | ABC0604 | -31 | 5.4 | CTACCATACTAGTATAAGTA |
| Bacillus licheniformis DSM 13 | BLi01354 | -44 | 6 | CAGCCATACTTGTATGGTAG |